View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9307-LTR4-TNT-insertion-7 (Length: 145)
Name: F9307-LTR4-TNT-insertion-7
Description: F9307-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9307-LTR4-TNT-insertion-7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 127; Significance: 6e-66; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 127; E-Value: 6e-66
Query Start/End: Original strand, 9 - 135
Target Start/End: Original strand, 31114045 - 31114171
Alignment:
| Q |
9 |
ttagtagcaaaaaatgaaaatatggtaaggttcaagaaaaaggagaaataatacagtagcgcgcttgtgtgtacatgtaaggcttcactcgttgggttta |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31114045 |
ttagtagcaaaaaatgaaaatatggtaaggttcaagaaaaaggagaaataatacagtagcgcgcttgtgtgtacatgtaaggcttcactcgttgggttta |
31114144 |
T |
 |
| Q |
109 |
ttatgaacatcatccaaattttgatta |
135 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
31114145 |
ttatgaacatcatccaaattttgatta |
31114171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University