View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9310-LTR4-TNT-insertion-4 (Length: 243)
Name: F9310-LTR4-TNT-insertion-4
Description: F9310-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9310-LTR4-TNT-insertion-4 |
 |  |
|
| [»] scaffold2079 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold2079 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: scaffold2079
Description:
Target: scaffold2079; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 8 - 140
Target Start/End: Original strand, 264 - 396
Alignment:
| Q |
8 |
ttttttgcaatattaagatagcctactatacttaatcgggtagaatttttctcatattgcgtaccccgaatccgcccataggtgaccaacatgaattgca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
264 |
ttttttgcaatattaagatagcctactatacttaatcgggtagaatttttctcatattgcgtaccccgaatccgcccataggtgaccaacatgaattgca |
363 |
T |
 |
| Q |
108 |
aattatgcgactatgctcaaatgcacaagttgg |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
364 |
aattatgcgactatgctcaaatgcacaagttgg |
396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold2079; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 205 - 234
Target Start/End: Original strand, 461 - 490
Alignment:
| Q |
205 |
ggaatctatttggtgggacaggttcaattg |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
461 |
ggaatctatttggtgggacaggttcaattg |
490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 8 - 139
Target Start/End: Original strand, 6242084 - 6242208
Alignment:
| Q |
8 |
ttttttgcaatattaagatagcctactatacttaatcgggtagaatttttctcatattgcgtaccccgaatccgcccataggtgaccaacatgaattgca |
107 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||| ||||| ||||||||||||||||| |||||||| ||||| |||| |||||||||||||| |
|
|
| T |
6242084 |
ttttttgcaatattaagttagtctactatacttaaccgggt-------ttctcatattgcgtaccgcgaatccgtccatacgtgatcaacatgaattgca |
6242176 |
T |
 |
| Q |
108 |
aattatgcgactatgctcaaatgcacaagttg |
139 |
Q |
| |
|
||||||| ||||||||||||||| |||||||| |
|
|
| T |
6242177 |
aattatgtgactatgctcaaatgaacaagttg |
6242208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 233
Target Start/End: Original strand, 6242274 - 6242302
Alignment:
| Q |
205 |
ggaatctatttggtgggacaggttcaatt |
233 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6242274 |
ggaatctatttggtgggacaggttcaatt |
6242302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 9 - 43
Target Start/End: Complemental strand, 10850749 - 10850715
Alignment:
| Q |
9 |
tttttgcaatattaagatagcctactatacttaat |
43 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |
|
|
| T |
10850749 |
tttttgcaatattaagatagcttactatacttaat |
10850715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 9 - 43
Target Start/End: Complemental strand, 10878263 - 10878229
Alignment:
| Q |
9 |
tttttgcaatattaagatagcctactatacttaat |
43 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |
|
|
| T |
10878263 |
tttttgcaatattaagatagcttactatacttaat |
10878229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University