View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9310-LTR4-TNT-insertion-5 (Length: 357)
Name: F9310-LTR4-TNT-insertion-5
Description: F9310-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9310-LTR4-TNT-insertion-5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 10 - 319
Target Start/End: Original strand, 40663139 - 40663448
Alignment:
| Q |
10 |
aaaggagtaatagaatgcagaagatgcattggattggaggaggtgatgctatggtagcgctgtgctgaaaatcaagcgtgcgtgaatgaatattattgtt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40663139 |
aaaggagtaatagaatgcagaagatgcattggattggaggaggtgatgctatggtagcgctgtgctgaaaatcaagcgtgcgtgaatgaatattattgtt |
40663238 |
T |
 |
| Q |
110 |
gtttttcatgttactatgtataagtaataaatctgctcatgtttacaaccagcttcgttggttggtcatcatctgttcaaactttttctcttttgactct |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40663239 |
gtttttcatgttactatgtataagtaataaatctgctcatgtttacaaccagcttcgttggttggtcatcatctgttcaaactttttctcttttgactct |
40663338 |
T |
 |
| Q |
210 |
ccaaactctccttcagtacctaactttcaacctaggacctaaggttgaggtttgtataaacctcttaggaaaccgcatacataagggaatatgaaattaa |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40663339 |
ccaaactctccttcagtacctaactttcaacctaggacctaaggttgaggtttgtataaacctcttaggaaaccgcatacataagggaatatgaaattaa |
40663438 |
T |
 |
| Q |
310 |
gcattttgat |
319 |
Q |
| |
|
|||||||||| |
|
|
| T |
40663439 |
gcattttgat |
40663448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University