View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9311-LTR4-TNT-insertion-12 (Length: 84)
Name: F9311-LTR4-TNT-insertion-12
Description: F9311-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9311-LTR4-TNT-insertion-12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 65; Significance: 3e-29; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 65; E-Value: 3e-29
Query Start/End: Original strand, 10 - 74
Target Start/End: Complemental strand, 12514500 - 12514436
Alignment:
Q |
10 |
aataagtaaatttgattaaaatggagtgtttcttggtttgagtggtttggagttgttatggatta |
74 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12514500 |
aataagtaaatttgattaaaatggagtgtttcttggtttgagtggtttggagttgttatggatta |
12514436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University