View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9311-LTR4-TNT-insertion-2 (Length: 182)
Name: F9311-LTR4-TNT-insertion-2
Description: F9311-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9311-LTR4-TNT-insertion-2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 10 - 172
Target Start/End: Original strand, 36217306 - 36217468
Alignment:
| Q |
10 |
ggtagagtcacagctgtagtaatgtttttcttcaccaggaatctttgagaatacaaagtcattaacctgttgcacagattctaaagtaggagcaagaatt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36217306 |
ggtagagtcacagctgtagtaatgtttttcttcaccaggaatctttgagaatacaaagtcattaacctgttgcacagattctaaagtaggagcaagaatt |
36217405 |
T |
|
| Q |
110 |
ccatgcttctgaaagtagtttggtgtgtcagcgttttgtagtaaattaggatacgcaaaatta |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36217406 |
ccatgcttctgaaagtagtttggtgtgtcagcgttttgtagtaaattaggatacgcaaaatta |
36217468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2309 times since January 2019
Visitors: 849