View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9313-LTR4-TNT-insertion-7 (Length: 415)
Name: F9313-LTR4-TNT-insertion-7
Description: F9313-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9313-LTR4-TNT-insertion-7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 3e-98; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 3e-98
Query Start/End: Original strand, 19 - 204
Target Start/End: Complemental strand, 25956467 - 25956282
Alignment:
| Q |
19 |
tatatgaactttggcgtcatggtagatttctctatgtctaaagaaattaagaagttctctgaaaataatggctcaagctattacaaactatcatctctta |
118 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25956467 |
tatatgaactttggcatcatggtagatttctctatgtctaaagaaattaagaagttctctgaaaataatggctcaagctattacaaactatcatctctta |
25956368 |
T |
 |
| Q |
119 |
aatggaattacatagggtgtttaattcgttttggtattaactgtggatgcactttctagatgatatgtaatataagtcttatcaat |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25956367 |
aatggaattacatagggtgtttaattcgttttggtattaactgtggatgcactttctagatgatatgtaatataagtcttatcaat |
25956282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 270 - 335
Target Start/End: Complemental strand, 25956216 - 25956151
Alignment:
| Q |
270 |
gaaaaggggctttgaaatttatttatatcaaataaaatatagagattatggcatatactgcgtaac |
335 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25956216 |
gaaaaggggctttgaaatttatttatatcaaataaaatatagagattatggcatatactgcgtaac |
25956151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University