View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9314-LTR4-TNT-insertion-8 (Length: 236)
Name: F9314-LTR4-TNT-insertion-8
Description: F9314-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9314-LTR4-TNT-insertion-8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 9 - 226
Target Start/End: Complemental strand, 40690157 - 40689940
Alignment:
Q |
9 |
ggaagcaaaggcaaacttagattctctatgatcatcttcaggtgcaggaaggttgagatccaaatccaaagacaaaacattccttttctttctaggatga |
108 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40690157 |
ggaagcaaaggcaaacttagattctctatgatcatcttcaggtgcaggaaggttgagatccaaatccaaagacaaaacattccttttctttctaggatga |
40690058 |
T |
 |
Q |
109 |
tcttcatcaggttccaaagccattgttgtcaaagagagtgtggtgttggctgcagaagttcccaccggtgcacggtggcgcctcatatggccacctagtg |
208 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40690057 |
tcttcatcaggttccaaagccattgttgtcaaagagagtgtggtgttggctgcagaagttcccaccggtgcacggtggcgcctcatatggccacctagtg |
40689958 |
T |
 |
Q |
209 |
cttgaccagatgtgaatt |
226 |
Q |
|
|
|||||||||||||||||| |
|
|
T |
40689957 |
cttgaccagatgtgaatt |
40689940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 16 - 104
Target Start/End: Complemental strand, 34714448 - 34714363
Alignment:
Q |
16 |
aaggcaaacttagattctctatgatcatcttcaggtgcaggaaggttgagatccaaatccaaagacaaaacattccttttctttctagg |
104 |
Q |
|
|
||||||||||| | ||||| ||||| |||| || ||||||||||||||||||||||||||||| | |||||| ||||||||||||| |
|
|
T |
34714448 |
aaggcaaacttgaactctctttgatcttcttaagctgcaggaaggttgagatccaaatccaaag---agacattcattttctttctagg |
34714363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 79
Target Start/End: Complemental strand, 34710740 - 34710689
Alignment:
Q |
28 |
gattctctatgatcatcttcaggtgcaggaaggttgagatccaaatccaaag |
79 |
Q |
|
|
|||||||| ||||| |||| || ||||||||||||||||||||||||||||| |
|
|
T |
34710740 |
gattctctttgatcttcttaagctgcaggaaggttgagatccaaatccaaag |
34710689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University