View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9316-LTR4-TNT-insertion-6 (Length: 182)
Name: F9316-LTR4-TNT-insertion-6
Description: F9316-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9316-LTR4-TNT-insertion-6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 8 - 172
Target Start/End: Original strand, 40131217 - 40131381
Alignment:
Q |
8 |
ctagttttcgaaggaaaaactacaacaacaacgaagtaccgatgagttctgacttcgtcttctctgcgcaaggttatagtcaacaacatgtcaaaaaacc |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40131217 |
ctagttttcgaaggaaaaactacaacaacaacgaagtaccgatgagttctgacttcgtcttctctgcgcaaggttatagtcaacaacatgtcaaaaaacc |
40131316 |
T |
 |
Q |
108 |
tccggatatttctaagtcatcaaccatgtccttccgtggcaaacttataggttccaatcagaatt |
172 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40131317 |
tccggatatttctaagtcatcaaccatgtccttccgtggcaaacttataggttccaatcagaatt |
40131381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University