View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9319-LTR4-TNT-insertion-3 (Length: 118)
Name: F9319-LTR4-TNT-insertion-3
Description: F9319-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9319-LTR4-TNT-insertion-3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 101; Significance: 2e-50; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 101; E-Value: 2e-50
Query Start/End: Original strand, 10 - 110
Target Start/End: Original strand, 6027131 - 6027231
Alignment:
| Q |
10 |
ctctatggtttataagttcagccaatgcccattctattgtagatgctgatgactcagttccagcaccaaaaatgttctgcaaattacatcactaataatt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6027131 |
ctctatggtttataagttcagccaatgcccattctattgtagatgctgatgactcagttccagcaccaaaaatgttctgcaaattacatcactaataatt |
6027230 |
T |
|
| Q |
110 |
a |
110 |
Q |
| |
|
| |
|
|
| T |
6027231 |
a |
6027231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 264 times since January 2019
Visitors: 962