View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9321-LTR4-TNT-insertion-3 (Length: 344)
Name: F9321-LTR4-TNT-insertion-3
Description: F9321-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9321-LTR4-TNT-insertion-3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 327; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 9 - 335
Target Start/End: Original strand, 25576278 - 25576604
Alignment:
Q |
9 |
atttaaccaaaccagttattgcagagaaattgtctcccagaagggtaaaatgggaagtgggctttcagcatcctagaacactgatggcggatgatattcc |
108 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25576278 |
atttaaccaaaccagttattgcagagaaattgtctcccagaagggtaaaatgggaagtgggctttcagcatcctagaacactgatggcggatgatattcc |
25576377 |
T |
 |
Q |
109 |
aactgaagttcagaagccaactctggaaactcatattactccccgttctggctgttcaaccatcatatctacagaggaaatgtgcatggttctgaataaa |
208 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25576378 |
aactgaagttcagaagccaactctggaaactcatattactccccgttctggctgttcaaccatcatatctacagaggaaatgtgcatggttctgaataaa |
25576477 |
T |
 |
Q |
209 |
agtggccttgaacttccggaaggacatgaaataaaattaacaacagatgacttcttcggtgctgctcggttgtggccttggtatattatttattaccgta |
308 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25576478 |
agtggccttgaacttccggaaggacatgaaataaaattaacaacagatgacttcttcggtgctgctcggttgtggccttggtatattatttattaccgta |
25576577 |
T |
 |
Q |
309 |
ggttgaagaagggcccaatttcaattg |
335 |
Q |
|
|
||||||||||||||||||||||||||| |
|
|
T |
25576578 |
ggttgaagaagggcccaatttcaattg |
25576604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 199 times since January 2019
Visitors: 952