View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9321-LTR4-TNT-insertion-5 (Length: 152)
Name: F9321-LTR4-TNT-insertion-5
Description: F9321-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9321-LTR4-TNT-insertion-5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 7e-69; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 7e-69
Query Start/End: Original strand, 7 - 142
Target Start/End: Original strand, 41010223 - 41010358
Alignment:
| Q |
7 |
acattgtgccaagagtcgcttttgtgtcttttgtggcaacagtggtggaatcccttcccattactgaggtggtcgatgacaacatttctgttccactagt |
106 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41010223 |
acattgtgccaagagttgcttttgtgtcttttgtggcaacagtggtggaatcccttcccattactgaggtggtcgatgacaacatttctgttccactagt |
41010322 |
T |
|
| Q |
107 |
aactatggcagtgacttttttaactttccatcatta |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
41010323 |
aactatggcagtgacttttttaactttccatcatta |
41010358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 231 times since January 2019
Visitors: 957