View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9324-LTR4-TNT-insertion-2 (Length: 131)
Name: F9324-LTR4-TNT-insertion-2
Description: F9324-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9324-LTR4-TNT-insertion-2 |
 |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 115; Significance: 8e-59; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 115; E-Value: 8e-59
Query Start/End: Original strand, 8 - 122
Target Start/End: Complemental strand, 27368470 - 27368356
Alignment:
| Q |
8 |
atatctctcttgacttacgtcacatgctttctgtctaacctataaacgtatggataatttaatgcttgtatacatttttaacttttacgaatgaggttta |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27368470 |
atatctctcttgacttacgtcacatgctttctgtctaacctataaacgtatggataatttaatgcttgtatacatttttaacttttacgaatgaggttta |
27368371 |
T |
 |
| Q |
108 |
acgtgattgcaattg |
122 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
27368370 |
acgtgattgcaattg |
27368356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 115; E-Value: 8e-59
Query Start/End: Original strand, 8 - 122
Target Start/End: Complemental strand, 27458817 - 27458703
Alignment:
| Q |
8 |
atatctctcttgacttacgtcacatgctttctgtctaacctataaacgtatggataatttaatgcttgtatacatttttaacttttacgaatgaggttta |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27458817 |
atatctctcttgacttacgtcacatgctttctgtctaacctataaacgtatggataatttaatgcttgtatacatttttaacttttacgaatgaggttta |
27458718 |
T |
 |
| Q |
108 |
acgtgattgcaattg |
122 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
27458717 |
acgtgattgcaattg |
27458703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 81 - 121
Target Start/End: Complemental strand, 27423594 - 27423554
Alignment:
| Q |
81 |
atttttaacttttacgaatgaggtttaacgtgattgcaatt |
121 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
27423594 |
atttttaacttttatgaatgaaatttaacgtgattgcaatt |
27423554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 81 - 121
Target Start/End: Original strand, 63769 - 63809
Alignment:
| Q |
81 |
atttttaacttttacgaatgaggtttaacgtgattgcaatt |
121 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
63769 |
atttttaacttttatgaatgaaatttaacgtgattgcaatt |
63809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University