View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9324-LTR4-TNT-insertion-3 (Length: 242)
Name: F9324-LTR4-TNT-insertion-3
Description: F9324-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9324-LTR4-TNT-insertion-3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 9 - 233
Target Start/End: Original strand, 45525664 - 45525888
Alignment:
| Q |
9 |
gcaccaacagggtccacaatctatgacattaattatgacgagacaattttttccaaagacaaatttgaaaactttttggattttactatcttttgttgtc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45525664 |
gcaccaacagggtccacaatctatgacattaattatgacgagacaattttttccaaagacaaatttgaaaactttttggattttactatcttttgttgtc |
45525763 |
T |
 |
| Q |
109 |
tctgggtgagaactgatcagtttaatgtnnnnnnnngtgctcttgcatggagacttagaggagaaggtatacatagacccaaggttcagtctcagatgtg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45525764 |
tctgggtgagaactgatcagtttaatgtaaaaaaaagtgctcttgcatggagacttagaggagaaggtatacatagacccaaggttcagtctcagatgtg |
45525863 |
T |
 |
| Q |
209 |
gatcatatataacgtgtgctaattg |
233 |
Q |
| |
|
||||||||||||||||||| ||||| |
|
|
| T |
45525864 |
gatcatatataacgtgtgccaattg |
45525888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University