View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9324-LTR4-TNT-insertion-4 (Length: 209)
Name: F9324-LTR4-TNT-insertion-4
Description: F9324-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9324-LTR4-TNT-insertion-4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 10 - 199
Target Start/End: Complemental strand, 36887262 - 36887073
Alignment:
| Q |
10 |
aatgatattgataattggtatccgtgttctatgtcaaaatgcagaaacattcaagggttagacctcactgggagtctatgcaggctttataatctccgaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36887262 |
aatgatattgataattggtatccgtgttctatgtcaaaatgcagaaacattcaagggttagacctcactgggagtctatgcaggctttataatctccgaa |
36887163 |
T |
|
| Q |
110 |
atttgaaacagctgtgagtgtttttgattttgcaaggcattagtattagattcttatatcaggatatgtgaatttcaagttatgctatta |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36887162 |
atttgaaacagctgtgagtgtttttgattttgcaaggcattagtattagattcttatatcaggatatgtgaatttcaagttatgctatta |
36887073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 203 times since January 2019
Visitors: 952