View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9324-LTR4-TNT-insertion-5 (Length: 78)
Name: F9324-LTR4-TNT-insertion-5
Description: F9324-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9324-LTR4-TNT-insertion-5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 61; Significance: 7e-27; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 61; E-Value: 7e-27
Query Start/End: Original strand, 8 - 68
Target Start/End: Complemental strand, 24068932 - 24068872
Alignment:
| Q |
8 |
acattcgacccttcttatggaagaggcataatccttggtcatttagatagttagtatatta |
68 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24068932 |
acattcgacccttcttatggaagaggcataatccttggtcatttagatagttagtatatta |
24068872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 244 times since January 2019
Visitors: 958