View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9325-LTR4-TNT-insertion-1 (Length: 223)
Name: F9325-LTR4-TNT-insertion-1
Description: F9325-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9325-LTR4-TNT-insertion-1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 7 - 213
Target Start/End: Original strand, 43083218 - 43083424
Alignment:
Q |
7 |
agaaggagccatttcaaaatggttcttgaagagtagttggcaacttccttttgcattgaggtagaggcctgtatatatatatggaaatgaaaaagtttaa |
106 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43083218 |
agaaggagccatttcaaaatggttcttgaagagtagttggcaacttccttttgcattgaggtagaggcctgtatatatatatggaaatgaaaaagtttaa |
43083317 |
T |
 |
Q |
107 |
ggaattgaatttgataaagaaacaattgtatgactaattgatagtgtgtttgtttatttgcactagcacacactttttccatttacaatctcttatcata |
206 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43083318 |
ggaattgaatttgataaagaaacaattgtatgactaattgatagtgtgtttgtttatttgcactagcacacactttttccatttacaatctcttatcata |
43083417 |
T |
 |
Q |
207 |
ttgatta |
213 |
Q |
|
|
||||||| |
|
|
T |
43083418 |
ttgatta |
43083424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2124 times since January 2019
Visitors: 7138