View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9326-LTR4-TNT-insertion-1 (Length: 263)
Name: F9326-LTR4-TNT-insertion-1
Description: F9326-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9326-LTR4-TNT-insertion-1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 245; Significance: 1e-136; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 9 - 253
Target Start/End: Complemental strand, 33325312 - 33325068
Alignment:
| Q |
9 |
cttgaaaaccccgaattgcctttccttcaatggcaaaagattttggctgttatggcaacccgacttcctaaagacctaagaaatgaggtagagggacaca |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33325312 |
cttgaaaaccccgaattgcctttccttcaatggcaaaagattttggctgttatggcaacccgacttcctaaagacctaagaaatgaggtagagggacaca |
33325213 |
T |
 |
| Q |
109 |
ttactgatttccccttctgattgaacgttttctgaagtgatttgatcttcccttgaattatgttgttttttagttggaagcaaaatataaggagttcgag |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33325212 |
ttactgatttccccttctgattgaacgttttctgaagtgatttgatcttcccttgaattatgttgttttttagttggaagcaaaatataaggagttcgag |
33325113 |
T |
 |
| Q |
209 |
agtatttcaagctcccaaattattgattttcctgcgaaattatta |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33325112 |
agtatttcaagctcccaaattattgattttcctgcgaaattatta |
33325068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 167 - 252
Target Start/End: Complemental strand, 33349817 - 33349732
Alignment:
| Q |
167 |
tatgttgttttttagttggaagcaaaatataaggagttcgagagtatttcaagctcccaaattattgattttcctgcgaaattatt |
252 |
Q |
| |
|
||||| |||||| |||||||||| ||||||||||||||||| | ||||||||||||||||| ||||||||| ||||| ||| |||| |
|
|
| T |
33349817 |
tatgtggtttttcagttggaagctaaatataaggagttcgaaattatttcaagctcccaaactattgatttccctgccaaactatt |
33349732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 25 - 107
Target Start/End: Complemental strand, 33349976 - 33349894
Alignment:
| Q |
25 |
tgcctttccttcaatggcaaaagattttggctgttatggcaacccgacttcctaaagacctaagaaatgaggtagagggacac |
107 |
Q |
| |
|
|||||||||||||||||||| || || || ||| |||| ||||| ||||| ||||| ||||||||||||||| |||||||| |
|
|
| T |
33349976 |
tgcctttccttcaatggcaagagtgctttgcagttttggcgacccgtcttcccaaagatctaagaaatgaggtaaagggacac |
33349894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University