View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9326-LTR4-TNT-insertion-11 (Length: 251)
Name: F9326-LTR4-TNT-insertion-11
Description: F9326-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9326-LTR4-TNT-insertion-11 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 8 - 242
Target Start/End: Original strand, 219367 - 219601
Alignment:
| Q |
8 |
ggtttaattgaagggttttatgacccttatgcttataatccagaagagggtaagtttattatgggtttgcaatttcaccctgagcgtatgagaaaaccta |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
219367 |
ggtttaattgaagggttttatgacccttatgcttataatccagaagagggtaagtttattatgggtttgcaatttcaccctgagcgtatgagaaaaccta |
219466 |
T |
|
| Q |
108 |
attcagatgattttgattaccctggatgcccatatgtctacaaggtttgcattttaaaatattaattcattgttactttcaagttttaacttttagctat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
219467 |
attcagatgattttgattaccctggatgcccatatgtctacaaggtttgcattttaaaatattaattcattgttactttcaagttttaacttttagctat |
219566 |
T |
|
| Q |
208 |
atatagtattattggaatttagtttgtcacaattg |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
219567 |
atatagtattattggaatttagtttgtcacaattg |
219601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 8 - 138
Target Start/End: Complemental strand, 31651839 - 31651709
Alignment:
| Q |
8 |
ggtttaattgaagggttttatgacccttatgcttataatccagaagagggtaagtttattatgggtttgcaatttcaccctgagcgtatgagaaaaccta |
107 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||| || ||||| ||||| ||| || |
|
|
| T |
31651839 |
ggtttgattgaagggttttatgaccctgatgcttataatccagaagagggtaagtttattatgggattgcagtttcatcccgagcggatgaggaaagctg |
31651740 |
T |
|
| Q |
108 |
attcagatgattttgattaccctggatgccc |
138 |
Q |
| |
|
|||||||||| |||||||| || |||||||| |
|
|
| T |
31651739 |
attcagatgaatttgattatccgggatgccc |
31651709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 373 times since January 2019
Visitors: 969