View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9326-LTR4-TNT-insertion-2 (Length: 145)
Name: F9326-LTR4-TNT-insertion-2
Description: F9326-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9326-LTR4-TNT-insertion-2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 123; Significance: 1e-63; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 123; E-Value: 1e-63
Query Start/End: Original strand, 13 - 135
Target Start/End: Original strand, 7546679 - 7546801
Alignment:
| Q |
13 |
gagttgcacgtatttgcttattgagagattggttaggtggttttgattagatgcaaaactaggattaatttaaattgaatgcatataagtatccctcaat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7546679 |
gagttgcacgtatttgcttattgagagattggttaggtggttttgattagatgcaaaactaggattaatttaaattgaatgcatataagtatccctcaat |
7546778 |
T |
 |
| Q |
113 |
atataatcatataagtaggaatt |
135 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
7546779 |
atataatcatataagtaggaatt |
7546801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University