View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9326-LTR4-TNT-insertion-3 (Length: 243)
Name: F9326-LTR4-TNT-insertion-3
Description: F9326-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9326-LTR4-TNT-insertion-3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 9 - 233
Target Start/End: Original strand, 34215116 - 34215340
Alignment:
| Q |
9 |
gacagtctttaatttgtcgtttttaagagagaccaaaacaatcccttgaaatttatgtatattacgaccataattgcattaacttatgaaactttaatca |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34215116 |
gacagtctttaatttgtcgtttttaagagagaccaaaacaatcccttgaaatttatgtatattacgaccataattgcattaacttatgaaactttaatca |
34215215 |
T |
 |
| Q |
109 |
tcctaaaaattgattacaagnnnnnnnnaatcttagtatgatggtacaaatatcatctcgtacacgcaactgcgagatcccggattcaaatcagggtgaa |
208 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34215216 |
tcctaaaaattgattacaagttttttttaatcttagtatgatggtacaaatatcatctcgtacacgcaactgcgagatcccggattcaaatcagggtgaa |
34215315 |
T |
 |
| Q |
209 |
aggtctaacaatatagtcactatta |
233 |
Q |
| |
|
||||||||||||||||||| ||||| |
|
|
| T |
34215316 |
aggtctaacaatatagtcattatta |
34215340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University