View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9326-LTR4-TNT-insertion-7 (Length: 346)
Name: F9326-LTR4-TNT-insertion-7
Description: F9326-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9326-LTR4-TNT-insertion-7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 248; Significance: 1e-137; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 8 - 259
Target Start/End: Original strand, 8255899 - 8256150
Alignment:
| Q |
8 |
gtattaaagatgctttctcaaacatctctatttatatgagaaaaatgcttcaatattgcaagacttgatcggtttcctagaaaagagtacagcttattgt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8255899 |
gtattaaagatgctttctcaaacatctctatttatatgagaaaaatgcttcaatattgcaagacttgatcggtttcctagaaaagagtatagcttattgt |
8255998 |
T |
|
| Q |
108 |
tcataagactggttctttttgttttggttaatgtgtatcaatgtgcatgtgggtaatagtgtaatcgtagcatccataccaatatcgtgaacacctcatt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8255999 |
tcataagactggttctttttgttttggttaatgtgtatcaatgtgcatgtgggtaatagtgtaatcgtagcatccataccaatatcgtgaacacctcatt |
8256098 |
T |
|
| Q |
208 |
ttttatgtattactttcttccaatcatatcaacaatttatcacatcactcac |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8256099 |
ttttatgtattactttcttccaatcatatcaacaatttatcacatcactcac |
8256150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 240 times since January 2019
Visitors: 958