View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9326-LTR4-TNT-insertion-9 (Length: 154)
Name: F9326-LTR4-TNT-insertion-9
Description: F9326-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9326-LTR4-TNT-insertion-9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 7e-75; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 7e-75
Query Start/End: Original strand, 7 - 148
Target Start/End: Complemental strand, 42537111 - 42536970
Alignment:
Q |
7 |
atcatcattatcagaaattgtggagttacaaggcatggacatgaatgatgaaagattggaaattgagtgtagaggattagaccacgcagactcagtggga |
106 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42537111 |
atcatcattatcagaaattgtggagttacaaggcatggacatgaatgatgaaagattggaaattgagtgtagaggattagaccacgcagactcagtggga |
42537012 |
T |
 |
Q |
107 |
ctaatagtgattagtacaagaacaaggtatttgattaattgg |
148 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42537011 |
ctaatagtgattagtacaagaacaaggtatttgattaattgg |
42536970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 20 - 111
Target Start/End: Complemental strand, 42530983 - 42530893
Alignment:
Q |
20 |
gaaattgtggagttacaaggcatggacatgaatgatgaaagattggaaattgagtgtagaggattagaccacgcagactcagtgggactaat |
111 |
Q |
|
|
||||| |||||| ||||||||||| ||||||| ||||||||| |||||||| ||||||||||||||||| ||| ||| |||||||||||| |
|
|
T |
42530983 |
gaaatcgtggagctacaaggcatgaacatgaagaatgaaagat-ggaaattgtatgtagaggattagaccatgcaaacttagtgggactaat |
42530893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University