View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9327-LTR4-TNT-insertion-1 (Length: 79)
Name: F9327-LTR4-TNT-insertion-1
Description: F9327-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9327-LTR4-TNT-insertion-1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 58; Significance: 4e-25; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 58; E-Value: 4e-25
Query Start/End: Original strand, 12 - 69
Target Start/End: Original strand, 40208330 - 40208387
Alignment:
Q |
12 |
gaatggggttgaagctagtggggttggatttttggatcaagttgtaattatcttatta |
69 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40208330 |
gaatggggttgaagctagtggggttggatttttggatcaagttgtaattatcttatta |
40208387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University