View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9327-LTR4-TNT-insertion-5 (Length: 227)
Name: F9327-LTR4-TNT-insertion-5
Description: F9327-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9327-LTR4-TNT-insertion-5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 3 - 187
Target Start/End: Complemental strand, 2675534 - 2675350
Alignment:
Q |
3 |
caacaacaactgggttttgctagctatttgtggtattatcttctgcattcctcgttactgtgccgctacgtctatcctattgaatgtgaaactgaactat |
102 |
Q |
|
|
|||| |||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2675534 |
caaccacaactaggttttgctagctatttgtggtattatcttctgcattcctcgtttctgtgccgctacgtctatcctattgaatgtgaaactgaactat |
2675435 |
T |
 |
Q |
103 |
ggataaagaaattcctgaaacaaattcatgttctataatttagttgtgtgaattgctttataactatatgttttgatgcgtatga |
187 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2675434 |
ggataaagaaattcctgaaacaaattcatgttctataatttagttgtgtgaattgctttataactatatgttttgatgcgtatga |
2675350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University