View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9327-LTR4-TNT-insertion-8 (Length: 210)
Name: F9327-LTR4-TNT-insertion-8
Description: F9327-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9327-LTR4-TNT-insertion-8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 9 - 195
Target Start/End: Original strand, 3462462 - 3462648
Alignment:
| Q |
9 |
tagcgaggactgtttgttctctgataacctttcttaacttctctacagcagctccgacaaacctccactgatggacgatagacctcattaggaatctatc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3462462 |
tagcgaggactgtttgttctctgataacctttcttaacttctctacagcagctccgacaaacctccactgatggacgatagacctcattaggaatctatc |
3462561 |
T |
|
| Q |
109 |
agcaacaaaaaaggaataacacatgttggtaagtttacaaagaaaactttgcagcttatcgttatttaaagatgttctcaagacaat |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3462562 |
agcaacaaaaaaggaataacacatgttggtaagtttacaaagaaaactttgcagcttatcgttatttaaagatgttctcaagacaat |
3462648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 539 times since January 2019
Visitors: 886