View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9328-LTR4-TNT-insertion-3 (Length: 320)
Name: F9328-LTR4-TNT-insertion-3
Description: F9328-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9328-LTR4-TNT-insertion-3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 303; Significance: 1e-170; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 11 - 313
Target Start/End: Original strand, 4592296 - 4592598
Alignment:
| Q |
11 |
tgcaatcataaatcgataacaaaaattaacatgccctgtcatgatttgctgtcagcatttcctactgtggtagtctcggccatatgtcaaagatcggacg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4592296 |
tgcaatcataaatcgataacaaaaattaacatgccctgtcatgatttgctgtcagcatttcctactgtggtagtctcggccatatgtcaaagatcggacg |
4592395 |
T |
|
| Q |
111 |
atcaagttgtattataaatcagatttcaaaatttaaaacacaaaccgttcgtacttcctctaacaatccatatttagtgactgtactgactgcagtcaat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4592396 |
atcaagttgtattataaatcagatttcaaaatttaaaacacaaaccgttcgtacttcctctaacaatccatatttagtgactgtactgactgcagtcaat |
4592495 |
T |
|
| Q |
211 |
ctggatcgatagtatagtattccataatgtacagatgtagcagaccaagttgatgtgtttttatattaaactagtttcctaccaaagtgctatataccaa |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4592496 |
ctggatcgatagtatagtattccataatgtacagatgtagcagaccaagttgatgtgtttttatattaaactagtttcctaccaaagtgctatataccaa |
4592595 |
T |
|
| Q |
311 |
ttg |
313 |
Q |
| |
|
||| |
|
|
| T |
4592596 |
ttg |
4592598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 197 - 286
Target Start/End: Original strand, 4584697 - 4584787
Alignment:
| Q |
197 |
tgactgcagtcaatctggatcgatagtat-agtattccataatgtacagatgtagcagaccaagttgatgtgtttttatattaaactagtt |
286 |
Q |
| |
|
|||||||| ||||||||||| |||| ||| |||||||||||||| ||||||||||||||| ||||||||| ||||| ||||||||||||| |
|
|
| T |
4584697 |
tgactgcattcaatctggattgataatattagtattccataatgcacagatgtagcagacgaagttgatgcgttttcgtattaaactagtt |
4584787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 44 - 95
Target Start/End: Original strand, 4584525 - 4584576
Alignment:
| Q |
44 |
ccctgtcatgatttgctgtcagcatttcctactgtggtagtctcggccatat |
95 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| ||| |||||||||||| |
|
|
| T |
4584525 |
ccctgtcatgatttgcagtcagcatttcctactgttgtaatctcggccatat |
4584576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2335 times since January 2019
Visitors: 8482