View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9329-LTR4-TNT-insertion-10 (Length: 104)
Name: F9329-LTR4-TNT-insertion-10
Description: F9329-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9329-LTR4-TNT-insertion-10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 87; Significance: 3e-42; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 87; E-Value: 3e-42
Query Start/End: Original strand, 8 - 94
Target Start/End: Complemental strand, 11834770 - 11834684
Alignment:
| Q |
8 |
gcgctgacgaggtagtaaagattttagggaaggaatttccacgtttaggtttgaagaaaaaagattgtattgaattgagttggatta |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11834770 |
gcgctgacgaggtagtaaagattttagggaaggaatttccacgtttaggtttgaagaaaaaagattgtattgaattgagttggatta |
11834684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.00000000000003
Query Start/End: Original strand, 27 - 94
Target Start/End: Original strand, 11821613 - 11821680
Alignment:
| Q |
27 |
gattttagggaaggaatttccacgtttaggtttgaagaaaaaagattgtattgaattgagttggatta |
94 |
Q |
| |
|
|||||||||||| | ||||||| ||| || |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
11821613 |
gattttagggaaacagtttccacttttgggattgaagaaaacagattgtattgaattgagttggatta |
11821680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 466 times since January 2019
Visitors: 980