View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9329-LTR4-TNT-insertion-13 (Length: 158)
Name: F9329-LTR4-TNT-insertion-13
Description: F9329-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9329-LTR4-TNT-insertion-13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 3e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 3e-74
Query Start/End: Original strand, 8 - 148
Target Start/End: Complemental strand, 46969038 - 46968898
Alignment:
| Q |
8 |
cattgtatgcggtttcttttgatcaaacattcaaatatgaaaaaataagctagttatatggtgcataagtgaagtaagtgttgtaccattcacaaattta |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46969038 |
cattgtatgcggtttcttttgatcaaacattcaaatatgaaaaaataagctagttatatggtgcataagtgaagtaagtgttgtaccattcacaaattta |
46968939 |
T |
 |
| Q |
108 |
tttccgccattggatcgagtgagatatggtggaatttatta |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46968938 |
tttccgccattggatcgagtgagatatggtggaatttatta |
46968898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 19 - 72
Target Start/End: Original strand, 32483124 - 32483177
Alignment:
| Q |
19 |
gtttcttttgatcaaacattcaaatatgaaaaaataagctagttatatggtgca |
72 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||| | || || ||||||||| |
|
|
| T |
32483124 |
gtttctctagatcaaacattcaaatatgaaaaaatatgttatttttatggtgca |
32483177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University