View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9329-LTR4-TNT-insertion-14 (Length: 148)
Name: F9329-LTR4-TNT-insertion-14
Description: F9329-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9329-LTR4-TNT-insertion-14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 8 - 140
Target Start/End: Complemental strand, 42964478 - 42964346
Alignment:
| Q |
8 |
aatgtgtcatttcttgacaactttcacattactttggcagatatttcaccaacttcagcttcacagttcttcttgtcaacagatggagtgttcaatgcaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42964478 |
aatgtgtcatttcttgacaactttcacattactttggcagatatttcaccaacttcagcttcacagttcttcttgtcaacagatggagtgttcaatgcaa |
42964379 |
T |
|
| Q |
108 |
gagcaagggttttgggtggtggtagctccatta |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42964378 |
gagcaagggttttgggtggtggtagctccatta |
42964346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 46; Significance: 1e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 6 - 135
Target Start/End: Original strand, 5499560 - 5499689
Alignment:
| Q |
6 |
caaatgtgtcatttcttgacaactttcacattactttggcagatatttcaccaacttcagcttcacagttcttcttgtcaacagatggagtgttcaatgc |
105 |
Q |
| |
|
||||||| |||||||||| ||||| || ||||| |||||||| ||||||||||||||||||| || | || | ||||| |||||||| |||||||| |
|
|
| T |
5499560 |
caaatgtaacatttcttgagaacttccatattaccttggcagacctttcaccaacttcagcttctcaatattttgtttcaactgatggagttttcaatgc |
5499659 |
T |
|
| Q |
106 |
aagagcaagggttttgggtggtggtagctc |
135 |
Q |
| |
|
||| | ||| ||||| |||||||||||||| |
|
|
| T |
5499660 |
aaggggaagagttttaggtggtggtagctc |
5499689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 531 times since January 2019
Visitors: 990