View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9329-LTR4-TNT-insertion-4 (Length: 186)
Name: F9329-LTR4-TNT-insertion-4
Description: F9329-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9329-LTR4-TNT-insertion-4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 2e-78; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 2e-78
Query Start/End: Original strand, 10 - 178
Target Start/End: Original strand, 8445483 - 8445651
Alignment:
| Q |
10 |
aaggaaaagagaagtgagtgttttgggaggatagaatgagtaaagggaagtggaagacacctcaacttgtatggatgtttatcnnnnnnncaataaaact |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8445483 |
aaggaaaagagaagtgagtgttttgggaggatagaatgagtaaagggaagtggaagacacctcaacttgtatggatgtttatctttttttcaataaaact |
8445582 |
T |
|
| Q |
110 |
aaaattattctgtatggagagccctaaaatacatttgaaattgaaatgatggatatgatatacaattgg |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8445583 |
aaaattattctgtatggagagccctaaaatacatttgaaattgaaatgatggatatgatatacaattgg |
8445651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 331 times since January 2019
Visitors: 967