View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9329-LTR4-TNT-insertion-9 (Length: 152)
Name: F9329-LTR4-TNT-insertion-9
Description: F9329-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9329-LTR4-TNT-insertion-9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 135; Significance: 1e-70; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 1e-70
Query Start/End: Original strand, 8 - 142
Target Start/End: Original strand, 38117648 - 38117782
Alignment:
| Q |
8 |
gtttagtagcaggttttccaacgtctactgattaagtgaaaatttatgaggtttataatatgtcgtcttaacctttacctggaacccattagtgcactgt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38117648 |
gtttagtagcaggttttccaacgtctactgattaagtgaaaatttatgaggtttataatatgtcgtcttaacctttacctggaacccattagtgcactgt |
38117747 |
T |
|
| Q |
108 |
taaatataagttctttgttagtgaacattgaatta |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
38117748 |
taaatataagttctttgttagtgaacattgaatta |
38117782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 9 - 116
Target Start/End: Original strand, 38161432 - 38161539
Alignment:
| Q |
9 |
tttagtagcaggttttccaacgtctactgattaagtgaaaatttatgaggtttataatatgtcgtcttaacctttacctggaacccattagtgcactgtt |
108 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||| |||| |||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38161432 |
tttaatagcatgttttccaacgtctactgattaaatgaatgtttatgaggtttataatatgtcttcttaacctttacctggaacccatttgtgcactgtt |
38161531 |
T |
|
| Q |
109 |
aaatataa |
116 |
Q |
| |
|
||| |||| |
|
|
| T |
38161532 |
aaaaataa |
38161539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 9 - 47
Target Start/End: Original strand, 38139875 - 38139913
Alignment:
| Q |
9 |
tttagtagcaggttttccaacgtctactgattaagtgaa |
47 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38139875 |
tttagtagcaggttttccaacgtctactgattaaatgaa |
38139913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 45; Significance: 5e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 5e-17
Query Start/End: Original strand, 9 - 61
Target Start/End: Original strand, 49005414 - 49005466
Alignment:
| Q |
9 |
tttagtagcaggttttccaacgtctactgattaagtgaaaatttatgaggttt |
61 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
49005414 |
tttagtagcaggttttcaaacgtctactgattaaatgaaaatttatgaggttt |
49005466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 444 times since January 2019
Visitors: 975