View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9331-LTR4-TNT-insertion-7 (Length: 140)
Name: F9331-LTR4-TNT-insertion-7
Description: F9331-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9331-LTR4-TNT-insertion-7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 125; Significance: 9e-65; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 125; E-Value: 9e-65
Query Start/End: Original strand, 8 - 132
Target Start/End: Complemental strand, 14192965 - 14192841
Alignment:
| Q |
8 |
cacagcccctggtattctgaagagggtaaccgaatgccctctgcacaattctagcaacccgatgatcgttccaaacctgcacatgttgagcaaccggggg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14192965 |
cacagcccctggtattctgaagagggtaaccgaatgccctctgcacaattctagcaacccgatgatcgttccaaacctgcacatgttgagcaaccggggg |
14192866 |
T |
|
| Q |
108 |
attgacgacctccgcaccattatta |
132 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
14192865 |
attgacgacctccgcaccattatta |
14192841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 290 times since January 2019
Visitors: 964