View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9332-LTR4-TNT-insertion-1 (Length: 280)
Name: F9332-LTR4-TNT-insertion-1
Description: F9332-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9332-LTR4-TNT-insertion-1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 9 - 272
Target Start/End: Original strand, 27439626 - 27439889
Alignment:
Q |
9 |
gtgatgagtggaattttggtgtggaaggttttgggagggtttatggatgaaagtatggaatctgacatagcgtgctgtgacggcttgcgcggcgggagtg |
108 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
27439626 |
gtgatgagtggaattttggtgtggaaggttttgggagggtttatggatgaaagtatggaatctgacatagcgtgctgtgacggcttgcgcggcgggagtg |
27439725 |
T |
 |
Q |
109 |
agtgaggtttcaagtgagagacgaactgagttttagggccacgtgcgggagtgcttgtacaaatggtatcaagttcgacatattgaataagtacttattt |
208 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
27439726 |
agtgaggtttcaagtgagagacgaactgagttttagggccacgtgcgggagtgcttgtacaaatggtatcaagttcgacatattgaataagtacttattt |
27439825 |
T |
 |
Q |
209 |
atccctctaatgaaaagtacctgtttatcattagttatattgtctcgtttgaaagatcaattgg |
272 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
27439826 |
atccctctaatgaaaagtacttgtttatcattagttatattgtctcgtttgaaagatcaattgg |
27439889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University