View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9332-LTR4-TNT-insertion-4 (Length: 199)
Name: F9332-LTR4-TNT-insertion-4
Description: F9332-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9332-LTR4-TNT-insertion-4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 10 - 189
Target Start/End: Original strand, 23088714 - 23088893
Alignment:
| Q |
10 |
tataacccaacctacatctgaacctgacaacaatgaccatcatctttctctgaatgcaatgaaagggacaaatagtatgggtattttgcgattcacggga |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23088714 |
tataacccaacctacatctgaacctgacaacaatgaccatcatctttctctgaatgcaatgaaagggacaaatagtatgggtattttgcgattcacggga |
23088813 |
T |
|
| Q |
110 |
cagatcggacacattgatgtgcaagtgctagtagatggaggtagttcagataatttcttgcagccaagagttgctgaatt |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
23088814 |
cagatcggacacattgatgtgcaagtgctagtagatggaggtagttcagataatttcttgcagccaagaattgctgaatt |
23088893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 258 times since January 2019
Visitors: 962