View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9333-LTR4-TNT-insertion-6 (Length: 564)
Name: F9333-LTR4-TNT-insertion-6
Description: F9333-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9333-LTR4-TNT-insertion-6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 502; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 502; E-Value: 0
Query Start/End: Original strand, 10 - 556
Target Start/End: Original strand, 27522275 - 27522821
Alignment:
| Q |
10 |
ccaaactcaaaggccaaaacatcgaccgaaaattcttagtatggacacactcacggccactctcatcgagttcatttccacattcatctttgtttttgcc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27522275 |
ccaaactcaaaggccaaaacatcgaccgaaaattcttagtatggacacactcacggccactctcatcgagttcatttccacattcatctttgtttttgcc |
27522374 |
T |
 |
| Q |
110 |
agcatatcgactctcgcatcatcgtaagaaatctcaccggagatgacgcggcctttagtctcatcgccaccgcgatcgctcacgcttttgccctctctgc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27522375 |
agcatatcgactctcgcatcatcgtaagaaatctcaccggagatgacgcggcctttagtctcatcgccaccgcgatcgctcacgcttttgccctctctgc |
27522474 |
T |
 |
| Q |
210 |
cgccgtgtatataggagctaggatcatcgccgtaaatccttacacgttatgtggccatgctaacccggctgtcacttttggggcttttatgggtggaaat |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27522475 |
cgccgtgtatataggagctaggatcatcgccgtaaatccttacacgttatgtggccatgctaacccggctgtcacttttggggcttttatgggtggaaat |
27522574 |
T |
 |
| Q |
310 |
attcacttcattcgttgccttggttactggattgctcagctccttgcctccgttggtgcttgcgcgctcctcatggtcgtcaccggtggacagtttatga |
409 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27522575 |
attcacttcattcgttgccttggttactggattgctcagctccttgcctccgttggtgcttgcgcgctcctcatggtcgtcaccggtggacagtttatga |
27522674 |
T |
 |
| Q |
410 |
ctgttagtagtgtttgttttttcaacaactaattaccaacatttgtgatttnnnnnnnnnnnnnnntttgttttagaaatcaaataggactttgagaggg |
509 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
27522675 |
ctgttagtagtgtttgttttttcaacaactaattaccaacatttgtgatttaaaaataaaaaaaaatttgttttagaaatcaaataggactttgagaggg |
27522774 |
T |
 |
| Q |
510 |
tgagatttcaaaattatggttgaaatggtttaactaactaaagatta |
556 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27522775 |
tgagatttcaaaattatggttgaaatggtttaactaactaaagatta |
27522821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University