View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9334-LTR4-TNT-insertion-2 (Length: 129)
Name: F9334-LTR4-TNT-insertion-2
Description: F9334-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9334-LTR4-TNT-insertion-2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 7e-56; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 7e-56
Query Start/End: Original strand, 10 - 119
Target Start/End: Complemental strand, 6218762 - 6218653
Alignment:
Q |
10 |
taaaacttttgataaacaaatgtattatatgttttaccaacccaagaacgcttagatgagatgtcatttgtctcttttagcttaatcaagatcatgtgta |
109 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6218762 |
taaaacttttgataaacaaatgtattatatgttttaccaacccaagaacgcttagatgagatgtcatttgtctcttttagcttaatcaagatcatgtgta |
6218663 |
T |
 |
Q |
110 |
cgtttgaatt |
119 |
Q |
|
|
|||||||||| |
|
|
T |
6218662 |
cgtttgaatt |
6218653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 28; Significance: 0.0000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 28; E-Value: 0.0000006
Query Start/End: Original strand, 47 - 98
Target Start/End: Original strand, 25084011 - 25084062
Alignment:
Q |
47 |
caacccaagaacgcttagatgagatgtcatttgtctcttttagcttaatcaa |
98 |
Q |
|
|
|||||||||||| ||||||||||||| || ||||||| |||||||||||| |
|
|
T |
25084011 |
caacccaagaacacttagatgagatgacacaagtctcttctagcttaatcaa |
25084062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 28; Significance: 0.0000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 28; E-Value: 0.0000006
Query Start/End: Original strand, 47 - 94
Target Start/End: Original strand, 3741104 - 3741151
Alignment:
Q |
47 |
caacccaagaacgcttagatgagatgtcatttgtctcttttagcttaa |
94 |
Q |
|
|
|||||||||| || |||||||||||||| | |||||||| |||||||| |
|
|
T |
3741104 |
caacccaagagcgtttagatgagatgtcgtgtgtctcttctagcttaa |
3741151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University