View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9335-LTR4-TNT-insertion-10 (Length: 195)
Name: F9335-LTR4-TNT-insertion-10
Description: F9335-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9335-LTR4-TNT-insertion-10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 8 - 186
Target Start/End: Complemental strand, 44701202 - 44701024
Alignment:
Q |
8 |
gtaaaggttacaaggacggcgtcacatgatttttgatatattagcaatgtttagtgtgttaatgattgccactacagagggaatacatgctattggcctt |
107 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
T |
44701202 |
gtaaaggttacaaggacagcgtcacatgatttttgatatattagcaatgtttagtgtgttaatgattgccactacagagggaatacatgctattggcttt |
44701103 |
T |
 |
Q |
108 |
cttagctccatcaagaagtaaaaatattgatcaagcaatttgtatttctttctttgctttcattctcaagtcctaattg |
186 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
44701102 |
cttagctccatcaagaagtaaaaatattgatcaagcaatttgtatttctttctttgctttcattctcaagtcccaattg |
44701024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University