View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9335-LTR4-TNT-insertion-3 (Length: 265)
Name: F9335-LTR4-TNT-insertion-3
Description: F9335-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9335-LTR4-TNT-insertion-3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 9 - 255
Target Start/End: Original strand, 21642438 - 21642684
Alignment:
| Q |
9 |
catcaagtttgggtgctttctttcggcagtccaaacgaggcgtccctcaagagaatcgtggaaagctataacgattcgcggataagtttcataagctcga |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21642438 |
catcaagtttgggtgctttctttcggcagtccaaacgaggcgtccctcaagagaatcgtggaaagctataacgattcgcggataagtttcataagctcga |
21642537 |
T |
|
| Q |
109 |
gttatgattttaagtactatggaaggtttcaaatggctttgcagacagaagctgatttggtttatatcgttgatgatgatatgatacctggaaagaaaat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21642538 |
gttatgattttaagtactatggaaggtttcaaatggctttgcagacagaagctgatttggtttatatcgttgatgatgatatgatacctggaaagaaaat |
21642637 |
T |
|
| Q |
209 |
gttggagattttggcacatgtagctgggactgaaaagtataagaatt |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21642638 |
gttggagattttggcacatgtagctgggactgaaaagtataagaatt |
21642684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 298 times since January 2019
Visitors: 964