View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9336-LTR4-TNT-insertion-1 (Length: 125)
Name: F9336-LTR4-TNT-insertion-1
Description: F9336-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9336-LTR4-TNT-insertion-1 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 107; Significance: 4e-54; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 107; E-Value: 4e-54
Query Start/End: Original strand, 9 - 115
Target Start/End: Original strand, 1418337 - 1418443
Alignment:
| Q |
9 |
atgtattaggaaaaatgtattcaacaccagctcttttaaactagcaattgtttcaagtcaaaggtggataagtttagtagcaccgatacaactattactt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1418337 |
atgtattaggaaaaatgtattcaacaccagctcttttaaactagcaattgtttcaagtcaaaggtggataagtttagtagcaccgatacaactattactt |
1418436 |
T |
|
| Q |
109 |
gtgatta |
115 |
Q |
| |
|
||||||| |
|
|
| T |
1418437 |
gtgatta |
1418443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 366 times since January 2019
Visitors: 969