View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9336-LTR4-TNT-insertion-4 (Length: 278)
Name: F9336-LTR4-TNT-insertion-4
Description: F9336-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9336-LTR4-TNT-insertion-4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 6 - 268
Target Start/End: Original strand, 10976879 - 10977141
Alignment:
| Q |
6 |
cagtaggaggacgcaacatgccacaagcttggcctcgttttgatagattatccttatgaatgaaataaattccatgatggatctctagaaagcaatgcac |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10976879 |
cagtaggaggacgcaacatgccacaagcttggcctcgttttgatagattatccttatgaatgaaataaattccatgatggatctctagaaagcaatgcac |
10976978 |
T |
|
| Q |
106 |
attccaataggtcgcttcaatgtgttgcagatgatgcgattgaaggagacaccatggaacaccataaccatatggagagggttgaacttgagcacactgt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10976979 |
attccaataggtcgcttcaatgtgttgcagatgatgcgattgaaggagacaccatggaacaccataaccatatggagagggttgaacttgagcacactgt |
10977078 |
T |
|
| Q |
206 |
tgcacatgaggctattcagtttgattttgaggagctcatcttcaaagagcaacaacatgatta |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10977079 |
tgcacatgaggctattcagtttgattttgaggagctcatcttcaaagagcaacaacatgatta |
10977141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 344 times since January 2019
Visitors: 967