View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9336-LTR4-TNT-insertion-7 (Length: 227)
Name: F9336-LTR4-TNT-insertion-7
Description: F9336-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9336-LTR4-TNT-insertion-7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 9 - 219
Target Start/End: Original strand, 5130789 - 5130999
Alignment:
| Q |
9 |
gcaatgcagctgaacatgcaggagcaatcatatttgctttcaagaacaaactggtttgaattttaagtgtttatttttcatatgatttccacaattccaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5130789 |
gcaatgcagctgaacatgcaggagcaatcatatttgctttcaagaacaaactggtttgaattttaagtgtttatttttcatatgatttccacaattccaa |
5130888 |
T |
|
| Q |
109 |
ttttctaggacaagtttcttgaaactaacttattgacattatattaggatatatctttgggtgttgctttaggttctgcaactcaaattggaatgtttgt |
208 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5130889 |
ttttctaagacaagtttcttgaaactaacttattgacattatattaggatatatctttgggtgttgctttaggttctgcaactcaaattggaatgtttgt |
5130988 |
T |
|
| Q |
209 |
ggtaagaatta |
219 |
Q |
| |
|
||||||||||| |
|
|
| T |
5130989 |
ggtaagaatta |
5130999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 9 - 63
Target Start/End: Complemental strand, 25013815 - 25013761
Alignment:
| Q |
9 |
gcaatgcagctgaacatgcaggagcaatcatatttgctttcaagaacaaactggt |
63 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| ||||||||||| ||||| |
|
|
| T |
25013815 |
gcaatgcagctgaacatgcaggagcaatcatttttgcattcaagaacaagctggt |
25013761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 11 - 63
Target Start/End: Complemental strand, 29784491 - 29784439
Alignment:
| Q |
11 |
aatgcagctgaacatgcaggagcaatcatatttgctttcaagaacaaactggt |
63 |
Q |
| |
|
||||| || |||||||| || ||||||||||||||| ||||||||||||||| |
|
|
| T |
29784491 |
aatgctgcagaacatgctggttcaatcatatttgcttacaagaacaaactggt |
29784439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 382 times since January 2019
Visitors: 970