View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9339-LTR4-TNT-insertion-2 (Length: 242)
Name: F9339-LTR4-TNT-insertion-2
Description: F9339-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9339-LTR4-TNT-insertion-2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 112; Significance: 1e-56; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 8 - 119
Target Start/End: Original strand, 39002719 - 39002830
Alignment:
| Q |
8 |
gaaaacacatcctaaatcttgtaagaaaataagggaagtatttattggcaattcaccacacttaatttgaatgattgtgtgtgaaaagcttctaagtatt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39002719 |
gaaaacacatcctaaatcttgtaagaaaataagggaagtatttattggcaattcaccacacttaatttgaatgattgtgtgtgaaaagcttctaagtatt |
39002818 |
T |
|
| Q |
108 |
gggtggtgtaac |
119 |
Q |
| |
|
|||||||||||| |
|
|
| T |
39002819 |
gggtggtgtaac |
39002830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 197 - 232
Target Start/End: Original strand, 39002908 - 39002943
Alignment:
| Q |
197 |
ttcacatcactttcaaattgcaccatgcatgcatta |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
39002908 |
ttcacatcactttcaaattgcaccatgcatgcatta |
39002943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 60 - 106
Target Start/End: Original strand, 39002293 - 39002339
Alignment:
| Q |
60 |
tcaccacacttaatttgaatgattgtgtgtgaaaagcttctaagtat |
106 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||| |||| |
|
|
| T |
39002293 |
tcaccacacttaatttgaatgattatgtgtgaaaagtttctatgtat |
39002339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 270 times since January 2019
Visitors: 1023