View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9339-LTR4-TNT-insertion-4 (Length: 143)
Name: F9339-LTR4-TNT-insertion-4
Description: F9339-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9339-LTR4-TNT-insertion-4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 125; Significance: 9e-65; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 125; E-Value: 9e-65
Query Start/End: Original strand, 9 - 133
Target Start/End: Complemental strand, 47178687 - 47178563
Alignment:
| Q |
9 |
gatggaaatgatatggagcgctggattcatcatagggtggatattaggtgactgcaggtttttatgacagccgtgaatccgaatccatgaaaatcattgt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47178687 |
gatggaaatgatatggagcgctggattcatcatagggtggatattaggtgactgcaggtttttatgacagccgtgaatccgaatccatgaaaatcattgt |
47178588 |
T |
|
| Q |
109 |
tagaagcgaagaaaatcaccaatta |
133 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
47178587 |
tagaagcgaagaaaatcaccaatta |
47178563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 18 - 65
Target Start/End: Original strand, 47179016 - 47179063
Alignment:
| Q |
18 |
gatatggagcgctggattcatcatagggtggatattaggtgactgcag |
65 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
47179016 |
gatatggagcgctggattcatcatagggtagatattaggtgactgcag |
47179063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 264 times since January 2019
Visitors: 1022