View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9339-LTR4-TNT-insertion-9 (Length: 67)
Name: F9339-LTR4-TNT-insertion-9
Description: F9339-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9339-LTR4-TNT-insertion-9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 53; Significance: 3e-22; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 53; E-Value: 3e-22
Query Start/End: Original strand, 7 - 59
Target Start/End: Original strand, 31693735 - 31693787
Alignment:
Q |
7 |
aggaattttgatgactggaccttgccatatggcacttagttgccatgtcatta |
59 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31693735 |
aggaattttgatgactggaccttgccatatggcacttagttgccatgtcatta |
31693787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University