View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9340-LTR4-TNT-insertion-6 (Length: 339)
Name: F9340-LTR4-TNT-insertion-6
Description: F9340-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9340-LTR4-TNT-insertion-6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 10 - 331
Target Start/End: Original strand, 26031277 - 26031598
Alignment:
Q |
10 |
cagatcgcgtacacaaacctttgtttaaaaccttgattactacactcctaatttgattttcttcatttgtttatatggttttgtgattgaatttatgatt |
109 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26031277 |
cagatcgcgtacacaaacctttgtttaaaaccttgattactacactcctaatttgattttcttcatttgtttatatggttttgtgattgaatttatgatt |
26031376 |
T |
 |
Q |
110 |
agaattgtcaaaattgctgttatctaggcctattcaccacttggatcacaagatggtgggagagatctcatccatgatcaaacggttgataggatagcca |
209 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26031377 |
agaattgtcaaaattgctgttatctaggcctattcaccacttggatcacaagatggtgggagagatctcatccatgatcaaacggttgataggatagcca |
26031476 |
T |
 |
Q |
210 |
agaagctgtacaagagtccagggcaagtgttggtgaagtgggccatgcagagagggacaagtgtcattcccaaatcaaccaacccaaataggatcaaaga |
309 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26031477 |
agaagctgaacaagagtccagggcaagtgttggtgaagtgggccatgcagagagggacaagtgtcattcccaaatcaaccaacccaaataggatcaaaga |
26031576 |
T |
 |
Q |
310 |
gaatgtggttgtcttcaattgg |
331 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
26031577 |
gaatgtggttgtcttcaattgg |
26031598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University