View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9343-LTR4-TNT-insertion-3 (Length: 104)
Name: F9343-LTR4-TNT-insertion-3
Description: F9343-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9343-LTR4-TNT-insertion-3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 85; Significance: 5e-41; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 85; E-Value: 5e-41
Query Start/End: Original strand, 8 - 96
Target Start/End: Original strand, 6348233 - 6348321
Alignment:
| Q |
8 |
agtttaaccaaaaatttaaaacgtataaaaccccgaattaaattgagtgtatatatatagcacaaagttcatattaaacgttcaattgg |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6348233 |
agtttaaccaaaaatttaaaacgtataaaaccccgaattgaattgagtgtatatatatagcacaaagttcatattaaacgttcaattgg |
6348321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 317 times since January 2019
Visitors: 965