View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9343-LTR4-TNT-insertion-7 (Length: 273)
Name: F9343-LTR4-TNT-insertion-7
Description: F9343-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9343-LTR4-TNT-insertion-7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 8 - 263
Target Start/End: Complemental strand, 28893144 - 28892889
Alignment:
| Q |
8 |
gaaatatctgtagatggagcgacagaggcaattggcaagctcacactcacaaagaggagatcccaagttcgaacctaaataaccacaaaaaacgtcgaat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28893144 |
gaaatatctgtagatggagcgacagaggcaattggcaagctcacactcacaaagaggagatcccaagttcgaacctaaataaccacaaaaaacgtcgaat |
28893045 |
T |
 |
| Q |
108 |
actacgtgaggtagaccttgtagacaatacttattagttataatttctttcnnnnnnnnntacttattagttataatataactctttttatactatttgt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28893044 |
actacgtgaggtagaccttgtagacaatacttattagttataatttctttcaaaaaaaaatacttattagttataatataactctttttatactatttgt |
28892945 |
T |
 |
| Q |
208 |
atgatgcaaatacaagtgattttgtttttacaaaagaaaattatatcatttcatta |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28892944 |
atgatgcaaatacaagtgattttgtttttacaaaagaaaattatatcatttcatta |
28892889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University