View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9344-LTR4-TNT-insertion-2 (Length: 197)
Name: F9344-LTR4-TNT-insertion-2
Description: F9344-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9344-LTR4-TNT-insertion-2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 9 - 188
Target Start/End: Original strand, 24884325 - 24884504
Alignment:
| Q |
9 |
cctgatccattacaccgtagtaggtagtaggcaataaattctataaacttctaagggttttcctctttccgagcctagtttcaatgatacattcaagctt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24884325 |
cctgatccattacaccgtagtaggtagtaggcaataaattctataaacttctaagggttttcctctttccgagcctagtttcaatgatacattcaagctt |
24884424 |
T |
|
| Q |
109 |
gtcaggtgttcgaatgccttagaggcgagggtcttactaggtaaattttgcattttgcctgatgtatttttctgcaattg |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24884425 |
gtcaggtgttcgaatgccttagaggcgagggtcttactaggtaaattttgcattttgcctgatgtatttttctgcaattg |
24884504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 100 - 164
Target Start/End: Original strand, 18713429 - 18713493
Alignment:
| Q |
100 |
ttcaagcttgtcaggtgttcgaatgccttagaggcgagggtcttactaggtaaattttgcatttt |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||| ||| ||||| |||| ||||| |
|
|
| T |
18713429 |
ttcaagcttgtcaggtgttcgaatgccttagaggcaaggaccttgctatgtaaagtttgtatttt |
18713493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 352 times since January 2019
Visitors: 967