View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9344-LTR4-TNT-insertion-7 (Length: 132)

Name: F9344-LTR4-TNT-insertion-7
Description: F9344-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9344-LTR4-TNT-insertion-7
F9344-LTR4-TNT-insertion-7
[»] chr5 (1 HSPs)
chr5 (8-122)||(10094690-10094804)
[»] chr4 (1 HSPs)
chr4 (10-42)||(48309242-48309274)


Alignment Details
Target: chr5 (Bit Score: 82; Significance: 4e-39; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 82; E-Value: 4e-39
Query Start/End: Original strand, 8 - 122
Target Start/End: Complemental strand, 10094804 - 10094690
Alignment:
8 ataagttatatataaatagaaagaaaaaatgatataacnnnnnnnnnnntgttcttcaagaatttatgaacttacatgattggtttgattccttgcatct 107  Q
    ||||||||||||||||||||||||||||||||||||||           |||||||||||||||||||||||||||||||||||||||||||||||||||    
10094804 ataagttatatataaatagaaagaaaaaatgatataacaaaaaaaaaaatgttcttcaagaatttatgaacttacatgattggtttgattccttgcatct 10094705  T
108 tttcccaacaaatta 122  Q
    |||||||||||||||    
10094704 tttcccaacaaatta 10094690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 10 - 42
Target Start/End: Complemental strand, 48309274 - 48309242
Alignment:
10 aagttatatataaatagaaagaaaaaatgatat 42  Q
    |||| ||||||||||||||||||||||||||||    
48309274 aagtgatatataaatagaaagaaaaaatgatat 48309242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University