View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9344-LTR4-TNT-insertion-7 (Length: 132)
Name: F9344-LTR4-TNT-insertion-7
Description: F9344-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9344-LTR4-TNT-insertion-7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 82; Significance: 4e-39; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 82; E-Value: 4e-39
Query Start/End: Original strand, 8 - 122
Target Start/End: Complemental strand, 10094804 - 10094690
Alignment:
| Q |
8 |
ataagttatatataaatagaaagaaaaaatgatataacnnnnnnnnnnntgttcttcaagaatttatgaacttacatgattggtttgattccttgcatct |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10094804 |
ataagttatatataaatagaaagaaaaaatgatataacaaaaaaaaaaatgttcttcaagaatttatgaacttacatgattggtttgattccttgcatct |
10094705 |
T |
 |
| Q |
108 |
tttcccaacaaatta |
122 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
10094704 |
tttcccaacaaatta |
10094690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 10 - 42
Target Start/End: Complemental strand, 48309274 - 48309242
Alignment:
| Q |
10 |
aagttatatataaatagaaagaaaaaatgatat |
42 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
48309274 |
aagtgatatataaatagaaagaaaaaatgatat |
48309242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University