View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9345-LTR4-TNT-insertion-7 (Length: 368)
Name: F9345-LTR4-TNT-insertion-7
Description: F9345-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9345-LTR4-TNT-insertion-7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 28 - 358
Target Start/End: Original strand, 5986995 - 5987325
Alignment:
Q |
28 |
aaaaacatagaaaaatatgcannnnnnngttgaccaagatgaaacaattaggcatcttctttgtgaatgtgaattgattagggagttttgaggtctccct |
127 |
Q |
|
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5986995 |
aaaaacatagaaaaatatgcatttttttgttgaccaagatgaaacaattaggcatcttctttgtgaatgtgaattgattagggagttttgaggtctccct |
5987094 |
T |
 |
Q |
128 |
tggtttaaagatcgcaagaattttatcaatatcatcccttttcattgaagcaaattcttcggttgttatcctaatgagaaatggtaatacctcaattgtt |
227 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5987095 |
tggtttaaagatcgcaagaattttatcaatatcatcccttttcattgaagtaaattcttcggttgttatcctaatgagaaatggtaatacctcaattgtt |
5987194 |
T |
 |
Q |
228 |
tttctccaacctattttcgatgataaaccatatggtcacaacgacttctttgactgtacgaaattcgtaacactctcaacctcccatattggaacatgca |
327 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5987195 |
tttctccaacctattttcgatgataaaccatatggtcacaacgacttctttgactgtacgaaattcgtaacactctcaacctcccatattggaacatgca |
5987294 |
T |
 |
Q |
328 |
tgtatcttatatttatttatagaggttatta |
358 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
5987295 |
tgtatcttatatttatttatagaggttatta |
5987325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University